View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_1D_low_16 (Length: 324)
Name: NF2811_1D_low_16
Description: NF2811_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_1D_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 12 - 303
Target Start/End: Complemental strand, 35071529 - 35071238
Alignment:
| Q |
12 |
gttgagtgagggagttgagattatcgggaagggtaccggcaagcttttgatcggagaggtttatgctggtgacgcggttgtcggatgagcatttgacgcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35071529 |
gttgagtgagggagttgagattatcgggaagggttccggcgagcttttgatcggagaggtttatgctggtgacgcggttgtcggatgagcatttgacgcc |
35071430 |
T |
 |
| Q |
112 |
ggaccattgacagaaggaagtattggaagaccagccgttaggagaaggtttaagggattgccgaaggctttgcatgacggtggcgtcatcgtcggccacc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35071429 |
ggaccattgacagaaggaagtattggaagaccagccgttaggagaaggtttaagggattgccgaaggctttgcatgacggtgccgtcatcgtcggccacc |
35071330 |
T |
 |
| Q |
212 |
acgaaggtggcggcgatgatcgcgatgatgatgaatgagatttggtgcattttggaaataaatgcggttggcagtagcaagagactactgtc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35071329 |
acgaaggtggcggcgatgatcgcgatgatgatgaatgagatttggtgcattttggaaataaatgcggttggcagtagcaagagactactgtc |
35071238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University