View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_1D_low_21 (Length: 289)
Name: NF2811_1D_low_21
Description: NF2811_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_1D_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 269
Target Start/End: Complemental strand, 9570345 - 9570090
Alignment:
| Q |
15 |
agaacttttgcattgtcaacctccctttcccttctcactctcgaccctgaaagaaaagaaagagagaatttcggaggnnnnnnnnn-gataagaataata |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9570345 |
agaacatttgcattgtcaacctccctttcccttctcactctcgtccatgaaagaaaagaaagagagaatttcggaggaaaaaaaaaagataagaataata |
9570246 |
T |
 |
| Q |
114 |
agaacagctgactaccaattgtgaaatctttaaagggatcaagactggtctgccgaagttttcgatgcacccattgaagcaactgcaggaggtaaaaggt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9570245 |
agaacagctgactaccaattgtgaaatctttaaagggatcaagattggtctgccgaagttttcgatgcacccattgaagcaactgcaggaggtaaaaggt |
9570146 |
T |
 |
| Q |
214 |
gtggatcaagccaaaggtttgaaagaacattttcatcataaattgttaagagttta |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9570145 |
gtggatcaagccaaaggtttgaaagaacattttcatcataaattgttaagagttta |
9570090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University