View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_1D_low_28 (Length: 256)
Name: NF2811_1D_low_28
Description: NF2811_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_1D_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 137
Target Start/End: Original strand, 51418633 - 51418758
Alignment:
| Q |
12 |
atgaagggaggcgcgtgaagatgacgaaaagggagacggttgaggaggtgtttgaggtggaccaagcggcagaggagttcatagagaggttttacagaga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51418633 |
atgaagggaggcgcgtgaagatgacgaaaagggagacggttgaggaggtgtttgaggtggatcaagcggcagaggagttcatagagaggttttacagaga |
51418732 |
T |
|
| Q |
112 |
gttgaggttgcagaaatggttggatc |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
51418733 |
gttgaggttgcagaaatggttggatc |
51418758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 71 - 137
Target Start/End: Original strand, 51413645 - 51413711
Alignment:
| Q |
71 |
gaccaagcggcagaggagttcatagagaggttttacagagagttgaggttgcagaaatggttggatc |
137 |
Q |
| |
|
||||| ||||| || ||||||||||| | |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51413645 |
gaccaggcggcggaagagttcatagaaaagttttacagagaattgaggttgcagaaatggttggatc |
51413711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University