View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_1D_low_45 (Length: 208)
Name: NF2811_1D_low_45
Description: NF2811_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_1D_low_45 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 38674775 - 38674589
Alignment:
| Q |
22 |
acaacaatctattcactcctaactcttgcgccaaaaccgttcgataaaattccccaactaaattcaacgccgtcagaaccaaatccaatcaacagtcgaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38674775 |
acaacaatctattcactcctaactcttgcgccaaaaccgttcgataaaatcccccaactaaatccaacgtcgtcagaaccaaatccaatcaacagtcgaa |
38674676 |
T |
|
| Q |
122 |
gaagatgtacgttgttaagagagacggtcgtcaagaggcggttcacttcgacaagataacagcgagattgaagaaactcagttacgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38674675 |
gaagatgtacgttgttaagagagacggtcgtcaagaggcggttcacttcgacaagataacagcgagattgaagaaactcagttacgg |
38674589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 117 - 208
Target Start/End: Complemental strand, 2062177 - 2062086
Alignment:
| Q |
117 |
tcgaagaagatgtacgttgttaagagagacggtcgtcaagaggcggttcacttcgacaagataacagcgagattgaagaaactcagttacgg |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||| || ||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
2062177 |
tcgaagaagatgtacgttgtggagagagatggtcgtcaagaggcggttcgttttgacaagataacggcgaggttgcagaaactcagttacgg |
2062086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University