View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_1D_low_49 (Length: 205)
Name: NF2811_1D_low_49
Description: NF2811_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_1D_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 9714831 - 9714711
Alignment:
| Q |
10 |
gtgtttagtcactgtttccgagcatgctttagaattattactgtatgcctcttaacattccttccaagcgtgttttcttcataatagcagcctggaattc |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||| ||||||| | ||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
9714831 |
gtgtttagtcactgtttccgagcatactttggaattattactgtttgcctctga-cattccttccatgcgtgttttcttcataatagcaacctggaattc |
9714733 |
T |
 |
| Q |
110 |
atcatgtaaattatcagttgaa |
131 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
9714732 |
ataatgtaaattatcagttgaa |
9714711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 145 - 203
Target Start/End: Complemental strand, 9713932 - 9713874
Alignment:
| Q |
145 |
cccctttcataaaacaattgtctagcaaggaaatctcttctaaaaagaatggacaagac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9713932 |
cccctttcataaaacaattgtctagcaaggaaatctcttctaaaaagaatggacaagac |
9713874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University