View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_1D_low_6 (Length: 494)
Name: NF2811_1D_low_6
Description: NF2811_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_1D_low_6 |
 |  |
|
| [»] chr6 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 415; Significance: 0; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 52 - 494
Target Start/End: Original strand, 23332595 - 23333037
Alignment:
| Q |
52 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
151 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
| Q |
152 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
 |
| Q |
252 |
agctcagcccaaccatcccgcagatagaccttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcat |
351 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332795 |
agctcagcccaaccatcccgcagataaaccttgccatttttcacgtggaccttgaccttgaacatgtttctgtttggatcacgcaacatgacataatcat |
23332894 |
T |
 |
| Q |
352 |
caacatgcacaccatattccttggcgaaacacgatggcaaccttgtcttcggctgaccaacacatcaaacacatgacacggttagttccaatcaacatac |
451 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332895 |
caacatgcaaaccatattccttggcgaaacacgatggcaaccttgtcttcggctgaccaacacatcaaacacatgacacggttagttccaatcaacatac |
23332994 |
T |
 |
| Q |
452 |
caaaacagtgcaatgcccactaatgaaccgactaactacatag |
494 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23332995 |
caaaacagtgcaatgcccacaaatgaaccgactaactacatag |
23333037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 279 - 373
Target Start/End: Complemental strand, 10955166 - 10955074
Alignment:
| Q |
279 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcatcaacatgcacaccatattcctt |
373 |
Q |
| |
|
|||||||| || ||| ||||||||| |||||||||||||| |||| |||||||||| |||||||| |||||||| |||| |||||||||||| |
|
|
| T |
10955166 |
accttgcccttcttcttgtggaccttaacctcgaacatgttcttgttaggatcacgca--atgacatagtcatcaacgtgcaaaccatattcctt |
10955074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 57
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
| Q |
15 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
57 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 57
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
| Q |
15 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
57 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 279 - 346
Target Start/End: Original strand, 2027692 - 2027759
Alignment:
| Q |
279 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacata |
346 |
Q |
| |
|
||||||||||||||| ||| || || ||||| |||||||| |||||||||||||||| |||||||| |
|
|
| T |
2027692 |
accttgccatttttcttgtgaactttaacctcaaacatgttcttgtttggatcacgcaaaatgacata |
2027759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University