View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_2D_high_12 (Length: 208)
Name: NF2811_2D_high_12
Description: NF2811_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_2D_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 19755415 - 19755226
Alignment:
| Q |
1 |
agctggttcgatgccgaggcatgtttcgatgtttgacaattatatttatcatcctattacatttgtctgctattcatctttcattctaaattattccaga |
100 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19755415 |
agctggttggatgccgaggcatgtttcaatgtttgacaattatatttatcatcctattacatttgtctactattcatctttcattctaaattattccaga |
19755316 |
T |
 |
| Q |
101 |
atgatatttgatttttgnnnnnnnnnntgttgcaattatcatgaaccannnnnnncccttgaaaatttgacagattgacagtaggtgtga |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19755315 |
atgatatttgatttttgaaaaaaaaaatgttgcaattatcatgaaccatttttttcccttgaaaatctgacagattgacagtaggtgtga |
19755226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 4 - 86
Target Start/End: Original strand, 33377216 - 33377298
Alignment:
| Q |
4 |
tggttcgatgccgaggcatgtttcgatgtttgacaattatatttatcatcctattacatttgtctgctattcatctttcattc |
86 |
Q |
| |
|
||||| |||||| |||||| |||| || ||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
33377216 |
tggttggatgccaaggcatttttcaatatttgacaattatatttatcatcctattacatttttcaactattaatctttcattc |
33377298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University