View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_2D_high_8 (Length: 277)
Name: NF2811_2D_high_8
Description: NF2811_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_2D_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 3 - 261
Target Start/End: Complemental strand, 52542503 - 52542245
Alignment:
| Q |
3 |
ttggtgttcttaatgaagactcttttcgaaagaatttcgtccttgtttatgaacttcttgatgaagtcattgtaagtactttttaccttggttcaaggtt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52542503 |
ttggtgttcttaatgaagactcttttcgaaagaatttcgtccttgtttatgaacttcttgatgaagtcattgtaagtactttttaccttggttcaaggtt |
52542404 |
T |
 |
| Q |
103 |
tgcatgtcaagtataacccatttagtgcagcaagatacactgttcagaataaaatgctgtcgagtagttgctttagcgttgcggaattagaacatactgc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
52542403 |
tgcatgtcaagtataacccatttagtgcagcaagatacactgttcagaataaaatgctgtcgagtagttactttagcgtagcggaattagaacatactgc |
52542304 |
T |
 |
| Q |
203 |
tattttccgcaaactgcgaatgataacnnnnnnnctgtttgatagatatgtgtacttgt |
261 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52542303 |
tattttccgcaaactgcgaatgataactttgtttctgtttgatagatatgtgtacttgt |
52542245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University