View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_2D_low_19 (Length: 271)
Name: NF2811_2D_low_19
Description: NF2811_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_2D_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 9546355 - 9546616
Alignment:
| Q |
1 |
gttcatactgatcatcttgatgttgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagnnnnnnngctac |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9546355 |
gttcatactgatcatcttgatgctgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagaaaaaaagctac |
9546454 |
T |
 |
| Q |
101 |
ttcttcttcagttgttatatccgatgaagaactcagtacagaaacagactcattctgtactgagtttttcaccggatc---atctttcttgacccgtttg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9546455 |
ttcttcttcagttgttatatccgatgaagaactcagtacagaaaaagactcgttctgtactgagtttttcaccggatcattatctttcttgacccgtttg |
9546554 |
T |
 |
| Q |
198 |
gatcgtggaccagttggattctttgatgattcagtttcactttctctatcttcctgaagaat |
259 |
Q |
| |
|
|||||||| ||||||||||||||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
9546555 |
gatcgtggtccagttggattctttgacgactcagtttcacttcctctatcttcctgaagaat |
9546616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University