View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_2D_low_20 (Length: 269)
Name: NF2811_2D_low_20
Description: NF2811_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_2D_low_20 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
| [»] scaffold0160 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 110 - 269
Target Start/End: Original strand, 9545964 - 9546123
Alignment:
| Q |
110 |
ccgaatccaatattatgtgttctcctatgtccacctagtgcttgacctgaagaaaattctctaaaacaaattggacattcatgaattttcttttcagtaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9545964 |
ccgaatccaatattatgtgttctcctatgtccacctagtgcttgacctgaagcaaattctctaaaacaaattggacattcatgaattttcttttcactaa |
9546063 |
T |
|
| Q |
210 |
cattgatannnnnnncaatgttaattttttcatgttgttgtgaaattgaataatcaccac |
269 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9546064 |
cattgatatttttttcaatgttaattttttcatgatgttgtgaaattgaataatcaccac |
9546123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 9545861 - 9545930
Alignment:
| Q |
1 |
atctaacaaactatctccaacattcgcggaaactcgagcaacctcgacgttccttctaaccattgttgtt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9545861 |
atctaacaaactatctccaacattcgcggaaactcgagcaaccttgacgttccttctaaccattgttgtt |
9545930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 205
Target Start/End: Original strand, 19594 - 19675
Alignment:
| Q |
124 |
atgtgttctcctatgtccacctagtgcttgacctgaagaaaattctctaaaacaaattggacattcatgaattttcttttca |
205 |
Q |
| |
|
||||||||| | |||||||| ||||||||||| ||| |||| ||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
19594 |
atgtgttcttttgtgtccaccaagtgcttgacccgaattaaatactcgaaaacataccggacattcatgaactttcttttca |
19675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University