View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_2D_low_23 (Length: 258)
Name: NF2811_2D_low_23
Description: NF2811_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_2D_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 143 - 239
Target Start/End: Original strand, 39545727 - 39545823
Alignment:
| Q |
143 |
gatatgcatatagtttcaatattctaagacggtgtctccggtgagagagtgtcactaatctcttattatgagcaagtattttataccgtcagataca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39545727 |
gatatgcatatagtttcaatattctaagacgctgtctccggtgagagagtgtcactaatctcttattatgagcaagtattttataccgtcggataca |
39545823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 12 - 103
Target Start/End: Original strand, 39545596 - 39545687
Alignment:
| Q |
12 |
gagtttggagttcggccaacagataaatacacttatgttatcttaaacgattcgtcatttgttgaagttcgttattctctttagtgctcaaa |
103 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
39545596 |
gagtctggagttcggccgacagataaataaacttatgttatcttaaacgattcatcatttgttgaagttcgtcattctctttagggctcaaa |
39545687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University