View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_2D_low_24 (Length: 239)
Name: NF2811_2D_low_24
Description: NF2811_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_2D_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 45483265 - 45483080
Alignment:
| Q |
1 |
ccactgcattagtagtcgttgagttgagatcaggtggtttagattttaatacagattttgattttaagaaaatagaaatgtcgaaattgaaatatgaatt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45483265 |
ccactgcgttagtagtcgttgagttgagatcaggtggtttagattttaatacagattttgattttaagaaaatagaaatgtcgaaattgaaatatgaatt |
45483166 |
T |
|
| Q |
101 |
gtccgatctcgatccaacactactaacatgttgactgcgtgatcacatccaaatccaagaagagtagcgtgtaatgtatcagatat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45483165 |
gtccgatctcgatccaacactactaacatgctgactgcgtgatcacattcaaatccaagaagagtagcgtataatgtatcagatat |
45483080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 235
Target Start/End: Complemental strand, 45483059 - 45483007
Alignment:
| Q |
187 |
taacacaattgctattccagct----gttagataggtttgacaaaagtataat |
235 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45483059 |
taacacagttgctattccagctagctgttagataggtttgacaaaagtataat |
45483007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University