View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811_2D_low_25 (Length: 229)
Name: NF2811_2D_low_25
Description: NF2811_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811_2D_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 11718136 - 11718336
Alignment:
| Q |
1 |
tagttttgtgctaattgttaatttcattagtaaatgtacaattattttgtgacatgttttatcatttcatgaacttttacaccaattgttacagcggacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11718136 |
tagttttgtgctaattgttaatttcattagtaactgtacaattattttgtgacatgttttatcatttcatgaacttttacaccaattgttacagcggacg |
11718235 |
T |
 |
| Q |
101 |
ccaagcattaagaaaaagacttgaagaggtaatcat--catttcattcatattcaataaaagcatatttactttttgttaattttgtttcatgtgttatt |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
11718236 |
ccaggcattaagaaaaagacttgaagaggtaatcatcacatttcattcatatgcaataaaagcatattaactatttgttaattttgtttcatgtgttatt |
11718335 |
T |
 |
| Q |
199 |
t |
199 |
Q |
| |
|
| |
|
|
| T |
11718336 |
t |
11718336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University