View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2812_high_4 (Length: 255)
Name: NF2812_high_4
Description: NF2812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2812_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 240
Target Start/End: Complemental strand, 42340153 - 42339926
Alignment:
| Q |
13 |
gaacctgtggaggatttagaaagattctggaaggcgtgatccgtaacggaaagggggaatttgagaggtaaatcgacgtaggttttaggatcgaaattgg |
112 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340153 |
gaaccggtggaggatttagaaagattatggaaggcgtgatccgtaacggaaagggggaatttgagaggtaaatcgacgtaggttttaggatcgaaattgg |
42340054 |
T |
|
| Q |
113 |
aattgccgaatgtgttgaatgcggtgtgttggagaatttcgagaaaggatacgagaagagttgaaggcttgacgtcgtccatggattgcgatgatgatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340053 |
aattgccgaatgtgttgaatgcggtgtgttggagaatttcgagaaaggatacgagaggagttgaaggcttgacgtcgtccatggattgcgatgatgatcc |
42339954 |
T |
|
| Q |
213 |
tgttactgttaaggtgaagagtagtaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42339953 |
tgttactgttaaggtgaagagtagtaat |
42339926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University