View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2812_low_6 (Length: 250)
Name: NF2812_low_6
Description: NF2812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2812_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 28 - 232
Target Start/End: Complemental strand, 44115050 - 44114846
Alignment:
| Q |
28 |
aaacgatcaatcagatctttatgtttcaagactgagatataaagcaccataaaatcccactttgaaaccagagttaattattcacattggaaactaaata |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44115050 |
aaacgatcaatcagatctttatgtttcaagactgagatataaagcaccagaaaatcccactttgaaaccagagttaattattcacattggaaactaaata |
44114951 |
T |
 |
| Q |
128 |
gcaattataaaatcttaactgaacccaaaaatgaataatattccaatgtgaatagaagcttgatcatcgcaattcttaattgtgtctattgcagtaccca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44114950 |
gcaattataaaatcttaactgaacccaaaaatgaataatattccaatgtgaatagaagcttgatcatcgcaattcttaattgtgtctattgcagtaccca |
44114851 |
T |
 |
| Q |
228 |
aatct |
232 |
Q |
| |
|
||||| |
|
|
| T |
44114850 |
aatct |
44114846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University