View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2813-Insertion-18 (Length: 79)
Name: NF2813-Insertion-18
Description: NF2813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2813-Insertion-18 |
![](./plan/images/spacer.gif) | ![NF2813-Insertion-18](./plan/images/spacer.gif) |
|
[»] chr4 (1 HSPs) |
![](./plan/images/spacer.gif) | ![chr4 (8-79)||(51716030-51716101)](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 79
Target Start/End: Original strand, 51716030 - 51716101
Alignment:
Q |
8 |
ttaacaacagttttcacagcaccgtccattgctagtaacaaaacaacgatgctctttcgtaacccttttctt |
79 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
T |
51716030 |
ttaacaacagttttcacagcaccgtccattgctactaactaaacaacgatgctctttcgtaacccttttctt |
51716101 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 17506 times since January 2019
Visitors: 1194