View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2813-Insertion-19 (Length: 52)
Name: NF2813-Insertion-19
Description: NF2813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2813-Insertion-19 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 4e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 44754246 - 44754291
Alignment:
Q |
7 |
agctatcacagcagatccaacttttcaatcagctttagctgcagca |
52 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44754246 |
agctatcacagcagatccaacttttcaatcagctttagctgcagca |
44754291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4297 times since January 2019
Visitors: 5866