View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2813R-Insertion-9 (Length: 341)
Name: NF2813R-Insertion-9
Description: NF2813R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2813R-Insertion-9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 8 - 326
Target Start/End: Original strand, 35915892 - 35916210
Alignment:
| Q |
8 |
agaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915892 |
agaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattc |
35915991 |
T |
 |
| Q |
108 |
aatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915992 |
aatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctc |
35916091 |
T |
 |
| Q |
208 |
aaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttcttt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916092 |
aaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttcttt |
35916191 |
T |
 |
| Q |
308 |
gcatttttcttaacaatca |
326 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35916192 |
gcatttttcttaacaatca |
35916210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University