View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_high_12 (Length: 366)
Name: NF2814_high_12
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 17 - 362
Target Start/End: Original strand, 35915892 - 35916237
Alignment:
| Q |
17 |
agaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915892 |
agaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattc |
35915991 |
T |
 |
| Q |
117 |
aatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915992 |
aatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctc |
35916091 |
T |
 |
| Q |
217 |
aaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttcttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916092 |
aaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttcttt |
35916191 |
T |
 |
| Q |
317 |
gcatttttcttaacaatcannnnnnngccttaatcctttgcttctc |
362 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35916192 |
gcatttttcttaacaatcatttttttgccttaatcctttggttctc |
35916237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University