View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_high_14 (Length: 332)
Name: NF2814_high_14
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 314
Target Start/End: Original strand, 49123154 - 49123452
Alignment:
| Q |
16 |
atggagggcagaaaactgatagaccggtcttcttgtggttccaacacaacctctagctgtgaagagactgatgcgctagagaaggatgagaaagaaaagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123154 |
atggagggcagaaaactgatagaccggtcttcttgtggttccaacacaacctctagctgtgaagagactgatgcgctagagaaggatgagaaagaaaagg |
49123253 |
T |
|
| Q |
116 |
aagaatgtaaaatacctgatgcagaccatttagctactgatcctagtagtcgtcgatatagaagcattagcaaccttcttgattcttggaaggaggtgtc |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123254 |
aagaatgtaaaatacctgatgcggaccatttagctaccgatcctagtagtcgtcgatatagaagcattagcaaccttcttgattcttggaaggaggtgtc |
49123353 |
T |
|
| Q |
216 |
tgaagaggtatcaatatatctcgcaatgaaatgtaatttaatgtgttgtatacatgtattgcttctgtccttatgtcaacgttttttacagggacgact |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
49123354 |
tgaagaggtatcaatatatctcacaatgaaatgtaatttaatgtgttgtatacatgtattgcttctgtccttatgtcagcgtcttttacagggacgact |
49123452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University