View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2814_high_20 (Length: 259)

Name: NF2814_high_20
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2814_high_20
NF2814_high_20
[»] chr1 (1 HSPs)
chr1 (16-245)||(6635166-6635395)
[»] chr3 (1 HSPs)
chr3 (21-239)||(52164067-52164285)


Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 6635395 - 6635166
Alignment:
16 atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
6635395 atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcgcgaa 6635296  T
116 tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6635295 tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaatta 6635196  T
216 caaaagaggatgagaatctatgaacttggt 245  Q
    ||||||||||||||||||||||||||||||    
6635195 caaaagaggatgagaatctatgaacttggt 6635166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 21 - 239
Target Start/End: Complemental strand, 52164285 - 52164067
Alignment:
21 gttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaatcgaa 120  Q
    ||||| |||||||| || ||||| || ||||||||||  | ||| || || ||| | |||||||| || || ||||||||| | || ||  |||||||||    
52164285 gttttagcagcacctgaatattgtaacgcaaatttcagttcttattttactccatcgttttggtctaatccttctttgtctctcacttttgcgaatcgaa 52164186  T
121 aagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgaggaatggatggaattacaaaa 220  Q
    |  ||||||| || || || || || ||||| |||||| | |||  |||| | || || ||||| ||  ||||||||||||| |||||||| || || ||    
52164185 agccttgttatttcaacacgggtgtgatggtgattgatttggaacgatggagagaaggggattatactgcaaagattgaggattggatggagttgcagaa 52164086  T
221 gaggatgagaatctatgaa 239  Q
    ||||||||| |||||||||    
52164085 gaggatgaggatctatgaa 52164067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University