View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_high_29 (Length: 229)
Name: NF2814_high_29
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 30400688 - 30400487
Alignment:
| Q |
19 |
agattaccccctcaaaaatttaaaacaaatttccataccaagtagcaaaatttattcacaaacatacagaagattggtcattaattaagaaatgaaaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30400688 |
agattaccccctcaaaaatttaaaacaaatttccataccaagtagcaaaatttattcacaaacatacacaagattggtcattaattaagaaatgaaaatg |
30400589 |
T |
 |
| Q |
119 |
tgaataacagtgttatttattaccgttatatgaatgactcttcctctcagttttgacccttgagctaatgcagccacccatgccagtgtgttattgatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30400588 |
tgaataacagtgttatttattaccgttatatgaatgactcttcctctcagttttgacccttgagctaatgcagccatccatgccagtgtgttattgatga |
30400489 |
T |
 |
| Q |
219 |
tg |
220 |
Q |
| |
|
|| |
|
|
| T |
30400488 |
tg |
30400487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 138
Target Start/End: Complemental strand, 30388344 - 30388308
Alignment:
| Q |
102 |
attaagaaatgaaaatgtgaataacagtgttatttat |
138 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
30388344 |
attaagaaaggaaaatgtgaataacaatgttatttat |
30388308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University