View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_high_30 (Length: 220)
Name: NF2814_high_30
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 42424131 - 42424314
Alignment:
| Q |
18 |
attattgaatttaaacttaggttttgttttttctggtgtgaattgtggttgtgat-ttttgaattgatcatatgaaagtgtttctatcttctattttatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42424131 |
attattgaatttaaacttaggttttgttttttctggtgtgaattgtggttgtgatgttttgaattgatc--atgaaagtgtttctatcttctattttatt |
42424228 |
T |
|
| Q |
117 |
ttccattgttcaacttaatcgnnnnnnnnnatgtcaacttgatcattattcgattttatgcgtaaataatttaaatcagtacatatt |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42424229 |
ttccattgttcaacttaatcg-ttttttttatgtcaacttgatcattattcgattttatgcgtaaataatttaaatcagtacatatt |
42424314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University