View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_low_10 (Length: 457)
Name: NF2814_low_10
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_low_10 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 6 - 439
Target Start/End: Complemental strand, 28764838 - 28764406
Alignment:
| Q |
6 |
gtcgaagaatatcaccgttaatcctccatgatgacctgttcactcaggtcttattattgcttcctgttaaatctcttatgcaactaaagtgcgtttgcaa |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28764838 |
gtcgaagattatcaccgttaatcctccatgatgacctgttcacccaggtcttattattgcttcctgttaaatctcttatgcaactaaagtgcgtttgcaa |
28764739 |
T |
|
| Q |
106 |
gtcttggaacaccctcatctccagtcccaccttcgttgaattacaccttcagcaatcacaacga---aaaaggcaactattactaacatatctaacatat |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28764738 |
gtcttggaacaccctcatctccggtcccaccttcgttgaattacaccttcagcaatcacaacgacgaaaaaggcaactactactaacatat--------- |
28764648 |
T |
|
| Q |
203 |
gtactctcatatgatgataatcgttgtttcgtacccttatccatatgtcgtttactgagtaacacatcaatcacccttgactgccgtagattgatgtaca |
302 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28764647 |
gtactctcatacgatgataatcgttggttcgtacccttatccatatgtcgtttactgagtaacacatcaatcacccttgactgccgtagattgatgtaca |
28764548 |
T |
|
| Q |
303 |
c-----cgattgtagcgaagtagttggttcctgcaatggattgatatgtttgcttggaaagtccgcaaataaacatcaagccatctggtttcgtgtttgg |
397 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
28764547 |
ctgattggattgtagcgaagtagttggttcctgtaatggattgatatgtttgcttggacggtccgcaaataagcatcgagccatctggttccgtgtttgg |
28764448 |
T |
|
| Q |
398 |
aacccagccacagggaatatatctgaaaaattaggatcttta |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28764447 |
aacccagccacagggaatatatctgaaaaattaggatcttta |
28764406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 65 - 127
Target Start/End: Complemental strand, 5437741 - 5437679
Alignment:
| Q |
65 |
cttcctgttaaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctcatctcc |
127 |
Q |
| |
|
||||||||||||| |||||||||| | ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5437741 |
cttcctgttaaatatcttatgcaaatgaagtgtgtttgcaagtcatggaacaccctcatctcc |
5437679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 18914152 - 18914114
Alignment:
| Q |
318 |
tagttggttcctgcaatggattgatatgtttgcttggaa |
356 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
18914152 |
tagttggttcctgcaatggattgatttgtttgcgtggaa |
18914114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 65 - 126
Target Start/End: Original strand, 553743 - 553804
Alignment:
| Q |
65 |
cttcctgttaaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctcatctc |
126 |
Q |
| |
|
||||||||| ||| |||||||| | | ||||| |||||||| || ||||||||||||||||| |
|
|
| T |
553743 |
cttcctgttgaatatcttatgcgaatgaagtgtgtttgcaaatcatggaacaccctcatctc |
553804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 18325428 - 18325484
Alignment:
| Q |
65 |
cttcctgttaaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctc |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||| || || |||||||||||| |
|
|
| T |
18325428 |
cttcctgtgaaatctcttatgcaactaaagtgctgttgtaaatcatggaacaccctc |
18325484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 349
Target Start/End: Original strand, 3625189 - 3625220
Alignment:
| Q |
318 |
tagttggttcctgcaatggattgatatgtttg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3625189 |
tagttggttcctgcaatggattgatatgtttg |
3625220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 74 - 127
Target Start/End: Original strand, 161095 - 161148
Alignment:
| Q |
74 |
aaatctcttatgcaactaaagtgcgtttgcaagtcttggaacaccctcatctcc |
127 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
161095 |
aaatctcttatgcagatgaagtgtgtttgcaagtcttggaaaaccctaatctcc |
161148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 320 - 349
Target Start/End: Complemental strand, 3561608 - 3561579
Alignment:
| Q |
320 |
gttggttcctgcaatggattgatatgtttg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3561608 |
gttggttcctgcaatggattgatatgtttg |
3561579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University