View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_low_25 (Length: 278)
Name: NF2814_low_25
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_low_25 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 52 - 278
Target Start/End: Complemental strand, 45037378 - 45037152
Alignment:
| Q |
52 |
atagcaagaacaagattgtaaaccaatgggattggcttataaatatccttgaaatacatattcaagaaatcttgttcagcaaaaggagtaggaggagtaa |
151 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037378 |
atagcaagaacaagattgtaaacaaatgggattggcttataaatatccttgaaatacatattcaagaaatcttgttcagcaaaaggagtaggaggagtaa |
45037279 |
T |
 |
| Q |
152 |
ctttaagtgtcttcaaaagatcgtggtaagtatcaatgcttggctcaaacaggaacatgccagcattgaagtaaagtgaaggaggttgacccatttcctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037278 |
ctttaagtgtcttcaaaagatcgtggtaagtatcaatgcttggctcaaacaggaacatgccagcattgaagtaaagtgaaggaggttgacccatttcctt |
45037179 |
T |
 |
| Q |
252 |
tggccaatgcactttttctggacattg |
278 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
45037178 |
tggccaatgaactttttctggacattg |
45037152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University