View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_low_28 (Length: 253)
Name: NF2814_low_28
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 42161989 - 42161836
Alignment:
| Q |
1 |
acgttcatcaaatacaaccctatgattctccaataagtctcttgcttggttgcaattatcaaacgtctttcttacacctcttaacgacgttgtatatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161989 |
acgttcatcaaatacaaccctatgattctccaataagtctcttgcttggttgcaattatcaaacgtctttcttacacctcttaacgacgttgtatatatt |
42161890 |
T |
 |
| Q |
101 |
actacggcgtcgtttccatttggtggacatttttctggatatctgcttagtggg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161889 |
actacggcgtcgtttccatttggtggacatttttctggatatctgcttagtggg |
42161836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 253
Target Start/End: Complemental strand, 42161775 - 42161737
Alignment:
| Q |
215 |
aatatgtctcgttttatgaatatgttatccttcagtttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161775 |
aatatgtctcgttttatgaatatgttatccttcagtttt |
42161737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University