View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_low_29 (Length: 250)
Name: NF2814_low_29
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_low_29 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 62 - 250
Target Start/End: Complemental strand, 24300769 - 24300581
Alignment:
| Q |
62 |
accaaacatactattcttaaagcggtttagtgatccagcatctatcaccgatgggcaactcaagaaatcaacccatctctaaagtgggctctaccctgta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24300769 |
accaaacatactattcttaaagcggtttagtgatccaacatctaccaccgatgggcaactcaagaaatcaacccatctctaaagtgggctttaccctgta |
24300670 |
T |
 |
| Q |
162 |
ggccgagaaaggctatttcaatgaatttcaatgacataataaattggtcaaaggaaggatacaattacaaaagtttttataaaaccgcc |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24300669 |
ggccgaggaaggctatttcaatgaatttcaatgacataataaattgatcaaaggaaggatacaattacaaaagtttttataaaaccgcc |
24300581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 11 - 100
Target Start/End: Original strand, 24241616 - 24241705
Alignment:
| Q |
11 |
cagagacatccagccgaagctcaccagaagtaaagcagatatcttcattcaaccaaacatactattcttaaagcggtttagtgatccagc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24241616 |
cagagacatccagccgaagctcactagaggtaaagcagatatctccattcaaccaaacatactattcttaaagcggtttggtgatccagc |
24241705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University