View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2814_low_33 (Length: 241)
Name: NF2814_low_33
Description: NF2814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2814_low_33 |
 | |
|
| [»] chr7 (5 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 64 - 241
Target Start/End: Complemental strand, 38314917 - 38314740
Alignment:
| Q |
64 |
atgtcttcgaaaagagatgtggagagtggggaaagaaccctttaccctacgatgcttgagagccctgaactaagatggtccttcatacgtaaggtttatt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38314917 |
atgtcttcgaaaagagatgtggagagtggggaaagaaccctttaccctacgatgcttgagagccctgaactaagatggtccttcatacgtaaggtttatt |
38314818 |
T |
|
| Q |
164 |
ccatcatcacttttcagttgcttctcaccgttgctgttgcctccgtcgttgttttcgttcctccgattcctcgtttct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38314817 |
ccatcatcacttttcagttgcttctcaccgttgctgttgcctccgtcgttgttttcgttcctccgattcctcgtttct |
38314740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 73 - 191
Target Start/End: Complemental strand, 38304426 - 38304308
Alignment:
| Q |
73 |
aaaagagatgtggagagtggggaaagaaccctttaccctacgatgcttgagagccctgaactaagatggtccttcatacgtaaggtttattccatcatca |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||| | ||||||| |||||| ||||||||| |||||||||||||||||| ||| |
|
|
| T |
38304426 |
aaaagagatgtggagagtggggaaagaatcctttaccctacgatacttgaaaaccctgaattaagattgtccttcattcgtaaggtttattccatcctca |
38304327 |
T |
|
| Q |
173 |
cttttcagttgcttctcac |
191 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
38304326 |
cctttcagttgcttctcac |
38304308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 85 - 223
Target Start/End: Complemental strand, 38272777 - 38272639
Alignment:
| Q |
85 |
gagagtggggaaagaaccctttaccctacgatgcttgagagccctgaactaagatggtccttcatacgtaaggtttattccatcatcacttttcagttgc |
184 |
Q |
| |
|
|||||||| | ||| ||||||||||||||| ||||||||||||||||| |||||||| ||||||||| |||||| || |||||| |||| |||||||||| |
|
|
| T |
38272777 |
gagagtggaggaagtaccctttaccctacgttgcttgagagccctgaattaagatggcccttcatacttaaggtatactccatcctcacctttcagttgc |
38272678 |
T |
|
| Q |
185 |
ttctcaccgttgctgttgcctccgtcgttgttttcgttc |
223 |
Q |
| |
|
|||||||| |||| |||||||| || ||||||||||||| |
|
|
| T |
38272677 |
ttctcaccattgccgttgcctcagtagttgttttcgttc |
38272639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 101 - 188
Target Start/End: Complemental strand, 38276475 - 38276388
Alignment:
| Q |
101 |
ccctttaccctacgatgcttgagagccctgaactaagatggtccttcatacgtaaggtttattccatcatcacttttcagttgcttct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
38276475 |
ccctttaccctacgatgcttgagagccctgaattaagatggtccttcatacgtaaggtatactccatcatcacaattcagttgcttct |
38276388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 38314959 - 38314930
Alignment:
| Q |
19 |
ggttacactacactatttggaaaagttgtg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38314959 |
ggttacactacactatttggaaaagttgtg |
38314930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University