View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2815_low_17 (Length: 264)
Name: NF2815_low_17
Description: NF2815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2815_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 29956344 - 29956099
Alignment:
| Q |
1 |
aattgcagtcgcagatgcagatgagtcggagccaatatattgtgagaagttatagaccaattcagctgatacggtcgaaattgcagttaactttgatagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29956344 |
aattgcagtcgcagatgcagatgagtcggagtccatatattgtgagaagttatagaccaattcagctgatacggtcgaaattgcagttaactttgatagc |
29956245 |
T |
 |
| Q |
101 |
aagatatatgctgctttagcataggagagtgagtctttgtaggtacaagtagctaggaaattatgtagtgatttaaattgcggtcaaggatgtagttagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29956244 |
aagatatatgctgctttagcataggagagtgagtctttgtaggtataaatagctaggaaattatgtagtgatttaaattgcggtcaaggatgtagttagg |
29956145 |
T |
 |
| Q |
201 |
taagagtccttgatttagtgaaaaattacagaaatattcagctgat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29956144 |
taagagtccttgatttagtgaaaaattacagaaatgttcagctgat |
29956099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University