View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2815_low_27 (Length: 201)
Name: NF2815_low_27
Description: NF2815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2815_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 183
Target Start/End: Complemental strand, 37362049 - 37361879
Alignment:
| Q |
13 |
cagagacaagagttcaagtacaataagtgcagtttacagcagcagaaaaatttgatggaattgttggcagaatataatgaaatgtatgaggaagagaatt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37362049 |
cagaaacaagagttcaagtacaataagtgcagtttacagcagcagaaaaatttgatggaattgttggcagaatataatgaaatgtatgaggaagagaatt |
37361950 |
T |
 |
| Q |
113 |
taatagagattgacttatccattggttcaatcaagtgctcaaggtttgaaaatgaaacataatcatcatac |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37361949 |
taatagagattgacttatccattggttcaatcaagtgctcaaggtttgaaaatgaaacataatcatcatac |
37361879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 67 - 168
Target Start/End: Complemental strand, 43113702 - 43113601
Alignment:
| Q |
67 |
atggaattgttggcagaatataatgaaatgtatgaggaagagaatttaatagagattgacttatccattggttcaatcaagtgctcaaggtttgaaaatg |
166 |
Q |
| |
|
||||| ||||| |||||| |||||| || |||||||||| || || ||||||||||| ||||| || || || ||||||| |||||||||||||| || |
|
|
| T |
43113702 |
atggagttgttatcagaattaaatgaagtgaatgaggaagaaaactttatagagattgatttatcaatgggatccatcaagtactcaaggtttgaaattg |
43113603 |
T |
 |
| Q |
167 |
aa |
168 |
Q |
| |
|
|| |
|
|
| T |
43113602 |
aa |
43113601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University