View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_high_20 (Length: 286)
Name: NF2816_high_20
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 286
Target Start/End: Original strand, 39378545 - 39378819
Alignment:
| Q |
12 |
gagatgaaccttgaggattagaagaaggagaagaaggaatagaacaaggatttttcattggttcaccacatagatcactattaccagaaaacacttttgt |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39378545 |
gagaagaaccttgaggattagaagaaggagaagaaggaatagaacaaggatttttcattggttcaccacatagatcactattaccagaaaacacttttgt |
39378644 |
T |
 |
| Q |
112 |
ttcctggttcaacaaaacaggggactctggtatttcaccagtgagattgttgaatgatagatcaacggttgcgttactcggaattttctcggcgaattcc |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39378645 |
ttcctggttcaacaaaacaggggactccggtatttcgccagtgagattgttgaatgatagatcaacggttgcgttactgggaattttctcggcgaattcc |
39378744 |
T |
 |
| Q |
212 |
ggtggaattttaccggaaaatctgttgtaagaaacattcaggtaacgcaaggaatcaccaccaaaatcttgagtt |
286 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
39378745 |
cgtggaatttcaccggaaaatctgttgtaggaaacattcaagtaacgcaaggaatcaccgccaaaatcttgagtt |
39378819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University