View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_high_21 (Length: 266)
Name: NF2816_high_21
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 20 - 130
Target Start/End: Complemental strand, 41839387 - 41839277
Alignment:
| Q |
20 |
actggctggggcccaagattgtaccctatctactggtgctagtagcatactagtaaattttcattgaaagtctcgttcaatgaactgagagagtgggata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41839387 |
actggctggggcccaagattgtaccctatctactggtgctagtagcatagtactaaattttcattgaaagtctcgttcaatgaactgagagagtgagata |
41839288 |
T |
|
| Q |
120 |
cgtatatatat |
130 |
Q |
| |
|
||||||||||| |
|
|
| T |
41839287 |
cgtatatatat |
41839277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University