View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_high_23 (Length: 250)
Name: NF2816_high_23
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 74 - 227
Target Start/End: Complemental strand, 46032566 - 46032413
Alignment:
| Q |
74 |
attaattatattcatacttgtttttgtttggaatttagttgtggattgacgcttatgtccaacacatttggaaggagacgtttgcaattctgtttcatga |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46032566 |
attaattatattcatacttgtttttgtttggaatttagttgtggattgacgcttatgtccaacacatttggaaggagacgtttgcaattctgtttcatga |
46032467 |
T |
|
| Q |
174 |
acaaattgccaaacagaattttcaccaagtccaccatcaaagctgagggagatg |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46032466 |
acaaattgccaaacagaattttcactaagtccaccatcaaagctgagggagatg |
46032413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 67 - 227
Target Start/End: Complemental strand, 46019910 - 46019741
Alignment:
| Q |
67 |
aagcaaaattaattatattcatacttgtttttgtttggaatttagttgtggattgacgctta------tgtccaacacatttg---gaaggagacgtttg |
157 |
Q |
| |
|
||||||||| |||| |||| ||| |||||| ||||| ||||||| ||||||||||| |||| || ||||||||| || | |||||||||||| |
|
|
| T |
46019910 |
aagcaaaatcaattgtattgatagttgtttgtgtttctaatttagctgtggattgacccttaacgagttggccaacacatatgagaggaggagacgtttg |
46019811 |
T |
|
| Q |
158 |
caattctgtttcatgaacaaattgccaaacagaattttcaccaagtccaccatcaaagctgagggagatg |
227 |
Q |
| |
|
||||| ||||||||||||||| |||| | | ||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
46019810 |
caattgtgtttcatgaacaaaatgcctgaaacaattttcacaatgtccgaaatcaaagctgagggagatg |
46019741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University