View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_high_29 (Length: 237)
Name: NF2816_high_29
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 5719187 - 5719403
Alignment:
| Q |
1 |
ttttaatttagctttaacttcaccacaccaaaacatgtctgaggagtttcttgaatccgaggttcnnnnnnncaaccagattcatcaatctgaagctgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5719187 |
ttttaatttagctttaacttcacca-----aaacatgtctgaggagtttcttgaatccgaggttctttttttcaaccagattcatcaatctgaagctgaa |
5719281 |
T |
|
| Q |
101 |
gacaagaaggtgctgatgaagctgaagaaggaggagatcaattctgatgatgaaattgatcaagctgctgacaacaagatggtgaggtccatgccgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5719282 |
gacaagaaggtgctgatgaagctgaagaaggaggagatcaattctgatgatgaaattgatcaagctgctgacaacaagatggtgaggtccatgccgatga |
5719381 |
T |
|
| Q |
201 |
atatcccgtctgaggggatatt |
222 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
5719382 |
atatcccctctgaggggatatt |
5719403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University