View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_low_25 (Length: 318)
Name: NF2816_low_25
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 309
Target Start/End: Original strand, 2122216 - 2122508
Alignment:
| Q |
18 |
gtattaacaagtctttttctcgcacccaccaaggtcactatgaatgttaggttagtatcttttggctttgcaacacaccttctacatttcaagtaactat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2122216 |
gtattaacaagtctttttctcgcacccaccaaggtcactatgaatgttaggttagtatcttttggctttgcaacacaccttcttcatttcaagtaactat |
2122315 |
T |
|
| Q |
118 |
gaacaccatgttcaaaccttttctaaggaatttcattattttattctttgatgatatcttgttatatagtaccttaatcatcagttcttcatagttgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2122316 |
gaacaccatgttcaaaccttttctaaggaatttcattattttattctttgatgatatcttgttatatagtaccttaataatcagttcttcatagttgaag |
2122415 |
T |
|
| Q |
218 |
tagaatatgtctcagcatcccatcattgaataactg-nnnnnnnnaggaaatcaacataaataacatagacactccgttaaaataagaataat |
309 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2122416 |
tagaatatgtctcagcatcccatcatcgaataactgttttttttaaggaaatcaacataaataacatagacactccgtcaaaataagaataat |
2122508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University