View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_low_26 (Length: 316)
Name: NF2816_low_26
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_low_26 |
 | |
|
| [»] scaffold0154 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0154 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 311
Target Start/End: Original strand, 5376 - 5679
Alignment:
| Q |
19 |
ctcttcgggtggatgttctttttaatattaaatctataccaaccccttgtctgcaatttatcccgaaaattttctactatgtattgtgtttggtttagtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5376 |
ctcttcgggtggatgttctttttaatattaaatctataccaaccccttgtgtgcaattgatcccgaaaattttctactatgtattgtgtttggtttagtg |
5475 |
T |
|
| Q |
119 |
gaataagtagttccaccatgactttgtactttagctagagaacttgaagaaaaacctaaagataaattcaaatttgtgggtgcgtt-----------att |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
5476 |
gaataagtagttccaccatgactttgtactttagctagagtacttgaggaaaaacctaaagataaattcaactttgtgggtgcgttattgttccctaatt |
5575 |
T |
|
| Q |
208 |
gttctgcatttctcaagtataaactttttgttagaccgttaagatgtctctgaggtaagcatcaagtatatatggaacataatttctcctcatttcatct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5576 |
gttctgcatttctcaagtataaactttttgttagaccgttaagatgcctctgaggtaagcatcaagtatatatggaacataatttctcctcatttcatat |
5675 |
T |
|
| Q |
308 |
cact |
311 |
Q |
| |
|
|||| |
|
|
| T |
5676 |
cact |
5679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University