View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_low_35 (Length: 247)
Name: NF2816_low_35
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 42 - 231
Target Start/End: Original strand, 49151368 - 49151557
Alignment:
| Q |
42 |
aagttttccccgccgcttaacagtgattcatctttatcgaaaaatctgtagtgcacacatagaaaaagaannnnnnnnnnnnnctcaattaatttgtgga |
141 |
Q |
| |
|
|||||||| || |||||||| |||||||||||| ||||| ||||||||||| |||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
49151368 |
aagttttcaccaccgcttaatagtgattcatctctatcggaaaatctgtagcgcacgcatagaaaaggaatttttgtttttttctcaattaatttgtgga |
49151467 |
T |
|
| Q |
142 |
tcctatcttatctattaannnnnnnnnngtttaaatatgataagaatttttgtctttctcacattgttcataaatccactttttgttcat |
231 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49151468 |
tcctatcttatctattaattttttttttgtttaaatatgataagaatttttgtctttctcacattgttcataaatccactttttgttcat |
49151557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University