View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2816_low_39 (Length: 241)
Name: NF2816_low_39
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2816_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 21937182 - 21936962
Alignment:
| Q |
1 |
catgtagaaacgttaaaatcgttaaaaagaaattgctcccatttagatgtcacaatcttcaagcgttcgtattgtttacacacaaaagtactagtacgca |
100 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
21937182 |
catgtagaaacgttaaaattgttaagaagaatatgctcccatttaagtgtcacaatcttcaagcgttcgtattatttacacacaaaagta---gtacgca |
21937086 |
T |
 |
| Q |
101 |
agtggttatgaaatcatcttcacttgggaaaatgaataatgaaaaaagagcatttatggtacaccatgacatctcaacaaacatatgactcccccatttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21937085 |
agtggttatgaaatcatcttcacttgggaaaatgaataatgaaaaaagagcatttatggtacaccatgacatctcaacaaacatatgaatcccccatttc |
21936986 |
T |
 |
| Q |
201 |
ttacgggaaaaatgaatgaattga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
21936985 |
ttacgggaaaaatgaatgaattga |
21936962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University