View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2816_low_40 (Length: 237)

Name: NF2816_low_40
Description: NF2816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2816_low_40
NF2816_low_40
[»] chr4 (1 HSPs)
chr4 (14-221)||(49151195-49151401)
[»] chr1 (1 HSPs)
chr1 (14-52)||(777992-778030)
[»] chr6 (1 HSPs)
chr6 (15-64)||(6762654-6762703)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 49151401 - 49151195
Alignment:
14 gagatgaatcactgttaagcggcggtgaaaactttgtaccaatattatggtgacgaaagatggtctttccttttttcttcnnnnnnnnnnnnnngattgt 113  Q
    ||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||                |||||    
49151401 gagatgaatcactattaagcggtggtgaaaactttgtaccaatattatggtgacaaaagatggtctttccttttttcttaaaaataaaaataaa-attgt 49151303  T
114 ctttccttttcaatttaggcatgggttaaatttaatatcgcttaattatattaaaataatgggctcaatccctaagttagtttataattgtaaatttcac 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
49151302 ctttccttttcaatttaggcatgggttaaatttaatatcgcttaattatatcaaaataatgggctcaatccctaagttagtttataattgtaaatttcac 49151203  T
214 cataattt 221  Q
    ||||||||    
49151202 cataattt 49151195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 778030 - 777992
Alignment:
14 gagatgaatcactgttaagcggcggtgaaaactttgtac 52  Q
    ||||||||||| ||||||||||||||| |||||||||||    
778030 gagatgaatcaatgttaagcggcggtggaaactttgtac 777992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 64
Target Start/End: Original strand, 6762654 - 6762703
Alignment:
15 agatgaatcactgttaagcggcggtgaaaactttgtaccaatattatggt 64  Q
    |||| |||||||||||||||| |||| ||||||||| | |||||||||||    
6762654 agattaatcactgttaagcggtggtggaaactttgtgctaatattatggt 6762703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University