View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2818_low_13 (Length: 243)
Name: NF2818_low_13
Description: NF2818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2818_low_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 36919055 - 36919280
Alignment:
| Q |
18 |
gtttttgaccatagaattagaggagatatttcatgttattggatctgaaatttttcagtctcttttaannnnnnnaactagtagatcaaaaggctaatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
36919055 |
gtttttgaccatagaattagaggagatatttcatgttattggatctgaaatttttcagtttcttttaatttttttaactagtagatcaaaaggctaatca |
36919154 |
T |
|
| Q |
118 |
atttaggaggaaattatagagtgtgggtgtgagtagcactcacgacgaattggaggagtcctaggttgctcatggactaaaggctgaaatgctttgcatt |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36919155 |
atttagaaggaaattatagagtgtgggtgtgagtagcactcacgacgaattggaggagtcctaggttgctcatggactaaaggctgaaatgctttgcact |
36919254 |
T |
|
| Q |
218 |
ttgaagaagaagatgatgatgatgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36919255 |
ttgaagaagaagatgatgatgatgat |
36919280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University