View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2818_low_16 (Length: 213)
Name: NF2818_low_16
Description: NF2818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2818_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 35479243 - 35479444
Alignment:
| Q |
1 |
ctaaagttataaatcttggctgtggcaacggttgcaattgcattccaatt----tatggatggttgcggtcaaatgcaattaatacaatcctaatcacat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35479243 |
ctaaagttataaatcttggctgtggcaacggttgcaattgcattccaattctaatatggaaggttgcggtcaaatgcaattaatacaatcctaatcacat |
35479342 |
T |
 |
| Q |
97 |
acataaaaaatatcaagtcatgccatgaccatacttttatagaaaccgtgatctcatccttatattgctgtgtcaattgctaacttattataatggaaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35479343 |
acataaaaaatatcaagtcatgccatgaccatacttttgtagaaaccgtgatctcatccttatattgttgtgtcaattgctaacttattataatggaaat |
35479442 |
T |
 |
| Q |
197 |
tg |
198 |
Q |
| |
|
|| |
|
|
| T |
35479443 |
tg |
35479444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University