View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2819_high_2 (Length: 359)
Name: NF2819_high_2
Description: NF2819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2819_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 20 - 353
Target Start/End: Original strand, 47366958 - 47367291
Alignment:
| Q |
20 |
agtatatttggtcctctagagctgaaagctgccaccactggggatggttgaaccccgaaccgggtaccgccaaatgcaattttagcagttggattgggag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47366958 |
agtatatttggtcctctagagctgaaagctgccaccactggggatggttgaaccccgaaccgggtaccgccaaatgcaattttagcagttggattgggag |
47367057 |
T |
|
| Q |
120 |
ctgaagaagcatacttctttatttcattgcttgctttctctcccaaagctgctgcagggaggagaaaggagtcagcaactagctcttcaccataatcttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367058 |
ctgaagaagcatacttctttatttcattgcttgctttctctcccaaagctgctgcagggaggagaaaggagtcagcaactagctcttcaccataatcttg |
47367157 |
T |
|
| Q |
220 |
gttgtttgctaaaatcatcccaattcctcctgcgcgtttgaccaccaaactcttttcagctctaggatttcctcctcggtcacatatcactatttttcct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367158 |
gttgtttgctaaaatcatcccaattcctcctgcgcgtttgaccaccaaactcttttcagctctaggatttcctcctcggtcacatatcactatttttcct |
47367257 |
T |
|
| Q |
320 |
gaaactttgctaggaatcaaactatctgtgctgc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47367258 |
gaaactttgctaggaatcaaactatctgtgctgc |
47367291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University