View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2819_low_8 (Length: 299)

Name: NF2819_low_8
Description: NF2819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2819_low_8
NF2819_low_8
[»] chr1 (1 HSPs)
chr1 (101-281)||(22547605-22547783)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 101 - 281
Target Start/End: Complemental strand, 22547783 - 22547605
Alignment:
101 taacctccgagacgagaaaaggtgatgtcgattggaaggttgcgaatgtcgtcgggagtttgcattgcgaatgaagatcacaggatgttttgcaacagtt 200  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22547783 taacctccgagacgagaaaaagtgatgtcgattggaaggttgcgaatgtcgtcgggagtttgcattgcgaatgaagatcacaggatgttttgcaacagtt 22547684  T
201 ttaaggaatgaaggttttgattttaaaacagtttaagacatcacacagtttcagcttcaacgcaattcaacttctggattc 281  Q
    |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| |||||||||||||||||||    
22547683 ttaaggaatgaaggttttgattttaaaacagtttaagacat--cacagtttcagcttcaactcaattcaacttctggattc 22547605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University