View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2819_low_8 (Length: 299)
Name: NF2819_low_8
Description: NF2819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2819_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 101 - 281
Target Start/End: Complemental strand, 22547783 - 22547605
Alignment:
| Q |
101 |
taacctccgagacgagaaaaggtgatgtcgattggaaggttgcgaatgtcgtcgggagtttgcattgcgaatgaagatcacaggatgttttgcaacagtt |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22547783 |
taacctccgagacgagaaaaagtgatgtcgattggaaggttgcgaatgtcgtcgggagtttgcattgcgaatgaagatcacaggatgttttgcaacagtt |
22547684 |
T |
 |
| Q |
201 |
ttaaggaatgaaggttttgattttaaaacagtttaagacatcacacagtttcagcttcaacgcaattcaacttctggattc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22547683 |
ttaaggaatgaaggttttgattttaaaacagtttaagacat--cacagtttcagcttcaactcaattcaacttctggattc |
22547605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University