View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2821_low_8 (Length: 203)
Name: NF2821_low_8
Description: NF2821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2821_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 35951145 - 35951318
Alignment:
| Q |
15 |
aatatactaataaatttatttgaataagaatcgctatacttatggtcttaatataattaattaagcctactcttttgtttcacgtttatagcaagcaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35951145 |
aatatactaataaatttatttgaataagaatcactatacttatggtcttaatataattaattaagcctacttttttgtttcacgtttatagcaagcaaaa |
35951244 |
T |
 |
| Q |
115 |
ttgattctggagttgtaaatttgatgttgacatgtttaattgttcttgaatacaaatgattttatcttcagaat |
188 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35951245 |
ttgattctggagctgtaaaattgatgttgacatgtttaattgttcttgaatacaaatgattttatcttcagaat |
35951318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 151
Target Start/End: Complemental strand, 2778550 - 2778510
Alignment:
| Q |
111 |
aaaattgattctggagttgtaaatttgatgttgacatgttt |
151 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
2778550 |
aaaattgattctgaagatgtaaaattgatgttgacatgttt |
2778510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University