View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2822_high_6 (Length: 326)
Name: NF2822_high_6
Description: NF2822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2822_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 16 - 317
Target Start/End: Complemental strand, 52273160 - 52272859
Alignment:
| Q |
16 |
tttacatcaatattttgtttcagcatgcacttaattgggatatttttactttagataaacactaatggatacttgggttgggtttcagatctaatgtttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273160 |
tttacatcaatattttgtttcagcatgcacttaattgggatatttttactttagataaacactaatggatacttgggttgggtttcagatctaatgtttc |
52273061 |
T |
|
| Q |
116 |
ttttcatgacaatgatggcttccatgtggatattgattctgagcctcgccccagtgaagagataactaataagattgaaaatgctgaatccgaagaaaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273060 |
ttttcatgacaatgatggcttccatgtggatattgattctgatcctcgccctagtgaagagataactaataagattgaaaatgctgaatccgaagaaaca |
52272961 |
T |
|
| Q |
216 |
ccagctacacgccctgcagagaatgatttaagcacactgcatattgatggttccaccgatgctgcagatcattcgagccgtgaaagtattccttctccta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52272960 |
ccagctacacgccctgcagagaatgatttaagcacactgcatattgatggttccaccgatgctgcagatcattcgagccgtgaaagtattccttctccta |
52272861 |
T |
|
| Q |
316 |
tg |
317 |
Q |
| |
|
|| |
|
|
| T |
52272860 |
tg |
52272859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University