View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2822_low_10 (Length: 245)
Name: NF2822_low_10
Description: NF2822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2822_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 1556970 - 1557114
Alignment:
| Q |
1 |
ttactatagttataattcagctgattcgaagaaagatgataaatttgtcaaccgattagaagaaatttgttactatagttcatctactagaagaaagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1556970 |
ttactatagttataattcagctgattcgaagaaagatgataaatttgtcaaccgattagaagaaatttgttactatagttcatctactagaagaaagata |
1557069 |
T |
 |
| Q |
101 |
aaatctttgctgacaattgatttcacctcaagagattagtctcta |
145 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
1557070 |
aaatctttgttgacaattgatttcacctcaagtgattagtctcta |
1557114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 175 - 228
Target Start/End: Original strand, 1557181 - 1557234
Alignment:
| Q |
175 |
cttaaccatagttaagtaatgaagtgaactagtattaaataagcataattgttt |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1557181 |
cttaaccatagttaagtaatcaagtgaactagtattaaataagcataattgttt |
1557234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University