View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2822_low_9 (Length: 287)
Name: NF2822_low_9
Description: NF2822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2822_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 109 - 281
Target Start/End: Original strand, 36011779 - 36011953
Alignment:
| Q |
109 |
gaatcggttgaaatgc-ggttcaacccgattttgatggattgagaatcgaatgtggttgaaaacaatgacaaacttattgattccgaactcaatcggttt |
207 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36011779 |
gaatcggttgaactgctggttcaacccgattttgatggattgagaatcgaatgtggttgaaaacaatgacaaacttactgattccgaactcaatcggttt |
36011878 |
T |
|
| Q |
208 |
gttcggtttgattatgaaaacactattatttacttcctccgtcccattttaagt-tggtcttttgttcatctcac |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36011879 |
gttcggtttgattatgaaaacactattatttacttcctccgtcccattttaagtcaagtcttttgttcatttcac |
36011953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 36011669 - 36011720
Alignment:
| Q |
1 |
tgatgatactttcatgattcaattggtttaaaccatgctcgaaccggatgct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011669 |
tgatgatactttcatgattcaattggtttaaaccatgctcgaaccggatgct |
36011720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University