View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2823_low_11 (Length: 233)
Name: NF2823_low_11
Description: NF2823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2823_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 1218645 - 1218429
Alignment:
| Q |
1 |
ttaagacttttggctatcactcatagtttactaataagtgggcaggtcactcgagctggcgagaaaaggtactacaaccgcttcgcagtacgagatgcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
1218645 |
ttaagacttttggctatcactcatagtttactaataagtgggcaggtcactcgagctggcgagaaaatgtactacaaccgctttgcagtacgagatgcag |
1218546 |
T |
|
| Q |
101 |
acataattggccgaacttgtgatcaaatatcgcgtgttctttgtttgcatttttcatatatgtaaccttacctttgaatcatggttgctattctaaattc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1218545 |
acataattggccgaacctgtgatcaaatatcgcgtgttctttgtttgcatttttcatatatgtaaccttacctttgaatcatggttgctattctaaattc |
1218446 |
T |
|
| Q |
201 |
taacaaagactttgaat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1218445 |
taacaaagactttgaat |
1218429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 4068451 - 4068407
Alignment:
| Q |
10 |
ttggctatcactcatagtttactaataagtgggcaggtcactcga |
54 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
4068451 |
ttggatatgactcgtagtttactaaaaagtgggcaggtcactcga |
4068407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University