View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2823_low_13 (Length: 207)
Name: NF2823_low_13
Description: NF2823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2823_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 6261278 - 6261103
Alignment:
| Q |
18 |
atgagttgttctgcgcttgttctgcatagaagagattttctagatatgtttatgagcatttttataagctctgtggcaatttctccggcgaagaaatcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261278 |
atgagttgttctgcgcttgttctgcatagaagagattttctagatatgtttatgagcatttttataagctctgtggcaatttctccggcgaagaaatcgt |
6261179 |
T |
|
| Q |
118 |
tcagtgccatttttgaacacttcttaactactattttcgtttcttcgttggttgtttcttttatactatgtctgtg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6261178 |
tcagtgccatttttgaacacttcttaactactactttcgtttcttcgttggttgtttcttttatactatgtttgtg |
6261103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University