View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2823_low_3 (Length: 442)
Name: NF2823_low_3
Description: NF2823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2823_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 208 - 420
Target Start/End: Complemental strand, 49084133 - 49083921
Alignment:
| Q |
208 |
ataaagaaacatgtaaggttccaatgtttgattttgtgaaggtttattcacctaaagagatagattttgccacaagggatgcaagttttccacatttcag |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084133 |
ataaagaaacatgtaaggttccaatgtttgattctgtgaaggtttattcacctaaagagatagattttgccacaagggatgcaagttttccacatttcag |
49084034 |
T |
 |
| Q |
308 |
gttttgatagcgtgacaaccgataaatctgaattccacaatgaagatctctctggtttatgagaatgattcataagcaaatcagtgagatattcatcaag |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084033 |
gttttgatagcgtgacaaccgataaatctgaattccacaatgaagatctctttggtttatgagaatgattcataagcaaatcagtgagatattcatcaag |
49083934 |
T |
 |
| Q |
408 |
attttggtctctg |
420 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49083933 |
attttggtctctg |
49083921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 99 - 200
Target Start/End: Original strand, 43396181 - 43396288
Alignment:
| Q |
99 |
tttaagttttgttcttgatcttgaatatgaaagattacatgt---gtattttagttgtagaaaa---atagccccaaggttgtaatttgttcagagaaca |
192 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||| || |||| ||||| ||||| || ||| |||||||| ||||||| || | |||| |
|
|
| T |
43396181 |
tttaagttttgttcttaatcttgaatatgaaggattacatgttatgtgttttggttgtggaaaagatatggccacaaggttggaatttgtccatacaaca |
43396280 |
T |
 |
| Q |
193 |
agcttttt |
200 |
Q |
| |
|
|||||||| |
|
|
| T |
43396281 |
agcttttt |
43396288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University